Understanding Exam 4 1 A Point Mutations

If you are looking for information about Exam 4 1 A Point Mutations, you have come to the right place. Missense: 5' - AUGUGGAACGCUAGCUGACCCGGC - 3' Readthrough: 5' - AUGUGGAACGCUUGCUGGCCCGGC - 3' ...

Key Takeaways about Exam 4 1 A Point Mutations

  • Created by Ross Firestone. Watch the next lesson: ...
  • References:
  • References:
  • References:
  • Coding Strand: 5' ATGTGGAACGCTTGCTGACCGGC 3' Template Strand: 3' TACACCTTGCGAACGACTGGGCCG 5' mRNA: 5' ...

Detailed Analysis of Exam 4 1 A Point Mutations

Normal: AUG UGG AAC GCU UGC UGA CCC GGC Nonsense: AUG UGA AAC GCU UGC UGA CCC GGC Missense: AUG UGG ... Sources: Class Slides Missense

Join the Amoeba Sisters as they explain gene and chromosome

We hope this detailed breakdown of Exam 4 1 A Point Mutations was helpful.

Exam 4 1 A Point Mutations.pdf

Size: 8.36 MB · Format: PDF · Secure Download

Download PDF Read Online

Related Documents